View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4264-Insertion-6 (Length: 40)
Name: NF4264-Insertion-6
Description: NF4264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4264-Insertion-6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.000000000009
Query Start/End: Original strand, 6 - 40
Target Start/End: Complemental strand, 25175013 - 25174979
Alignment:
| Q |
6 |
atcatcaggtagacgaactcatcaagcttctaaga |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25175013 |
atcatcaggtagacgaactcatcaagcttctaaga |
25174979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University