View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4264_low_9 (Length: 225)
Name: NF4264_low_9
Description: NF4264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4264_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 92 - 225
Target Start/End: Original strand, 1036809 - 1036942
Alignment:
| Q |
92 |
aaataagcccaataacccaatattattcctatttgcactccacctcttcattaagtgactttctccacgagtggctcttcttaattttccaactgtcgcg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036809 |
aaataagcccaataacccaatattattcctatttgcactccacctcttcattaagtgactttctccacgagtggctcttcttaattttccaactgtcgcg |
1036908 |
T |
 |
| Q |
192 |
acacgatctttgtagtatacaatgcgatttaaat |
225 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
1036909 |
acacgatctttgtagtatacgatgcgatttaaat |
1036942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University