View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4265-Insertion-19 (Length: 54)
Name: NF4265-Insertion-19
Description: NF4265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4265-Insertion-19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 43; Significance: 2e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 5 - 51
Target Start/End: Original strand, 4774779 - 4774825
Alignment:
| Q |
5 |
aactaactaattatctttacaatatctaaggatttgtagagagaaat |
51 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774779 |
aactaagtaattatctttacaatatctaaggatttgtagagagaaat |
4774825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University