View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4265-Insertion-2 (Length: 150)
Name: NF4265-Insertion-2
Description: NF4265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4265-Insertion-2 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 5 - 150
Target Start/End: Original strand, 9909445 - 9909590
Alignment:
| Q |
5 |
agaattcacattcccaatgacccttcttctgtttctagtaatcatgttgaagaaattgatgatgctagttttgttgaattggaaaagctacacaaatctg |
104 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9909445 |
agaaatcacattcccaatgacccttcttctgtttctagtaatcatgttgaagaaattgatgatgctagttttgttgaattggaaaagctacacaaatctg |
9909544 |
T |
|
| Q |
105 |
aacttttgggtgaaaatgttttgttgaataaattggataattgggt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9909545 |
aacttttgggtgaaaatgttttgttgaataaattggataattgggt |
9909590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University