View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4265-Insertion-8 (Length: 115)
Name: NF4265-Insertion-8
Description: NF4265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4265-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 2e-49
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 23040543 - 23040657
Alignment:
| Q |
1 |
aattatacatgcatatcaaattcaaaccaacctaatttcctagatatgcataaaaattcccacaaaatatcaaaaatgaaacctaagatacgaataattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23040543 |
aattatacatgcatatcaaattcaaaccaacctaatttcctagctatgcataaagattctcacaaaatatcaaaaatgaaacctaagatacgaataattc |
23040642 |
T |
|
| Q |
101 |
acgtatatgcacccg |
115 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
23040643 |
acgtatacgcacccg |
23040657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University