View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4265_high_23 (Length: 235)
Name: NF4265_high_23
Description: NF4265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4265_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 50384595 - 50384373
Alignment:
| Q |
1 |
tagaaaggaggcaaaaatgacgaaccaacgcccggtgatgaattggacggtgcgactcttcatgtctcccaaaccatgaaccccaatggagttccctacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| || |||||| |
|
|
| T |
50384595 |
tagaaaggaggcaaaaatgacgaaccaacgcccggtgatgaattggacggtgagactcttcatgtctcccaaaccatgaacaccaatggaattacctacc |
50384496 |
T |
|
| Q |
101 |
gccataatattgcgaattgcaagaagata----nnnnnnnncttcttgcaa----tagctagctagcttgcacttgctgccacttatggttatagaagta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50384495 |
gccataatattgcgaattgcaagaagatatatttttttcttcttcttgcaatagctagctagctagcttgcacttgctgccacttatggttatagaagta |
50384396 |
T |
|
| Q |
193 |
gtgaggtatgtataaatgagatggagc |
219 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
50384395 |
gtgag----gtataaatgagatggagc |
50384373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 2 - 106
Target Start/End: Complemental strand, 50393013 - 50392909
Alignment:
| Q |
2 |
agaaaggaggcaaaaatgacgaaccaacgcccggtgatgaattggacggtgcgactcttcatgtctcccaaaccatgaaccccaatggagttccctaccg |
101 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||| ||| |||||||||||||||| ||||| ||||| |||||||| || || |||| |
|
|
| T |
50393013 |
agaaaggaggcaaaaatgacgaaccaccgtccggtgatgaattggacagtgagactcttcatgtctcctaaaccgtgaacaccaatggaattaccaaccg |
50392914 |
T |
|
| Q |
102 |
ccata |
106 |
Q |
| |
|
||||| |
|
|
| T |
50392913 |
ccata |
50392909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 50389740 - 50389654
Alignment:
| Q |
1 |
tagaaaggaggcaaaaatgacgaaccaacgcccggtgatgaattggacggtgcgactcttcatgtctcccaaaccatgaaccccaat |
87 |
Q |
| |
|
||||||||||||||||||||| ||||| || |||||||||| |||||||||| ||||||||||||||||| || ||||||| ||||| |
|
|
| T |
50389740 |
tagaaaggaggcaaaaatgacaaaccaccgtccggtgatgacttggacggtgagactcttcatgtctccccaatcatgaacaccaat |
50389654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University