View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4265_high_25 (Length: 234)
Name: NF4265_high_25
Description: NF4265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4265_high_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 47963834 - 47963631
Alignment:
| Q |
15 |
atgaaggatgagtatgaattgtcacgcagaaa-ttcgaaacattatttattgtggtggagctttttcatgtttagtttaatatgcgggctcacatgttat |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47963834 |
atgaaggatgagtatgaattctcacgcagaaaattcgaaacattatttattgtggtggagctttttcatgtttagtttaatatgcgggctcacatgttat |
47963735 |
T |
|
| Q |
114 |
catttcatgattaaaagattaagtacaaaaatgtataaataaatgattttattgaggagaactacgataaaaagataaaaatgtttgatgtagtattttc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47963734 |
catttcatgattaaaagattaagtacaaaaatgtataaataaatgattttgttgaggagaactacgataaatagataaaaatgtttgatgtagtattttc |
47963635 |
T |
|
| Q |
214 |
atta |
217 |
Q |
| |
|
|||| |
|
|
| T |
47963634 |
atta |
47963631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University