View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4265_low_27 (Length: 236)
Name: NF4265_low_27
Description: NF4265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4265_low_27 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 32340907 - 32341127
Alignment:
| Q |
16 |
ctaaccacggttacattcacacattcatgtctagccattctacttgcataggctagtgcctcggcatcatctgcacctccaatgaagagaactgcaatat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32340907 |
ctaaccacggttacattcacacattcatgtctagccattctacttgcataggctagtgcctcggcatcatctgcacctccaatgaagagaactgcaatat |
32341006 |
T |
|
| Q |
116 |
agtatgttgccttggatattaaaagtgatggagaaccacttaagatgcctcggtcgatgaggattccaaccgaacaaggagctctttcgaggactttaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32341007 |
agtatgttgccttggatattaaaagtgatggagaaccacttaagatgcctcggtcgatgaggattccaaccgaacaaggagctctttcgaggactttaat |
32341106 |
T |
|
| Q |
216 |
gtttactctttggattgctcc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32341107 |
gtttactctttggattgctcc |
32341127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 103
Target Start/End: Original strand, 36062442 - 36062529
Alignment:
| Q |
16 |
ctaaccacggttacattcacacattcatgtctagccattctacttgc-ataggctagtgcctcggcatcatctgcacctccaatgaaga |
103 |
Q |
| |
|
|||||||| |||||||||| | ||||||||||| |||||| | || |||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
36062442 |
ctaaccaccgttacattcaaatattcatgtctacacattct-cgagctataggctagtgcttcgatatcatctgcacctccaatgaaga |
36062529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University