View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4265_low_28 (Length: 235)

Name: NF4265_low_28
Description: NF4265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4265_low_28
NF4265_low_28
[»] chr1 (3 HSPs)
chr1 (1-219)||(50384373-50384595)
chr1 (2-106)||(50392909-50393013)
chr1 (1-87)||(50389654-50389740)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 50384595 - 50384373
Alignment:
1 tagaaaggaggcaaaaatgacgaaccaacgcccggtgatgaattggacggtgcgactcttcatgtctcccaaaccatgaaccccaatggagttccctacc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| || ||||||    
50384595 tagaaaggaggcaaaaatgacgaaccaacgcccggtgatgaattggacggtgagactcttcatgtctcccaaaccatgaacaccaatggaattacctacc 50384496  T
101 gccataatattgcgaattgcaagaagata----nnnnnnnncttcttgcaa----tagctagctagcttgcacttgctgccacttatggttatagaagta 192  Q
    |||||||||||||||||||||||||||||            ||||||||||    |||||||||||||||||||||||||||||||||||||||||||||    
50384495 gccataatattgcgaattgcaagaagatatatttttttcttcttcttgcaatagctagctagctagcttgcacttgctgccacttatggttatagaagta 50384396  T
193 gtgaggtatgtataaatgagatggagc 219  Q
    |||||    ||||||||||||||||||    
50384395 gtgag----gtataaatgagatggagc 50384373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 2 - 106
Target Start/End: Complemental strand, 50393013 - 50392909
Alignment:
2 agaaaggaggcaaaaatgacgaaccaacgcccggtgatgaattggacggtgcgactcttcatgtctcccaaaccatgaaccccaatggagttccctaccg 101  Q
    |||||||||||||||||||||||||| || ||||||||||||||||| ||| |||||||||||||||| ||||| ||||| |||||||| || || ||||    
50393013 agaaaggaggcaaaaatgacgaaccaccgtccggtgatgaattggacagtgagactcttcatgtctcctaaaccgtgaacaccaatggaattaccaaccg 50392914  T
102 ccata 106  Q
    |||||    
50392913 ccata 50392909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 50389740 - 50389654
Alignment:
1 tagaaaggaggcaaaaatgacgaaccaacgcccggtgatgaattggacggtgcgactcttcatgtctcccaaaccatgaaccccaat 87  Q
    ||||||||||||||||||||| ||||| || |||||||||| |||||||||| ||||||||||||||||| || ||||||| |||||    
50389740 tagaaaggaggcaaaaatgacaaaccaccgtccggtgatgacttggacggtgagactcttcatgtctccccaatcatgaacaccaat 50389654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University