View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4265_low_34 (Length: 212)
Name: NF4265_low_34
Description: NF4265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4265_low_34 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 212
Target Start/End: Complemental strand, 28267954 - 28267750
Alignment:
| Q |
8 |
gacatcatcaagtgaaaaagaaaatacctagatcctcaatatttggaattgttgctgataaagcaaggaagcggacctgagccagaggatttaatttcat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267954 |
gacaacatcaagtgaaaaagaaaatacctagatcctcaatatttggaattgttgctgataaagcgaggaagcggacctgagccagaggatttaatttcat |
28267855 |
T |
 |
| Q |
108 |
ttttggattgcaagaaataatttttattctgctaacaattgcttccagcacagctccacgtggatcattcagcagatggacttcatcaattagtagaagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28267854 |
ttttggattgcaagaaataatttttattctgctaacaattgcttccagcgcagctccacgtggatcattcagcagatggacttcatcaattagtagaagt |
28267755 |
T |
 |
| Q |
208 |
gctat |
212 |
Q |
| |
|
||||| |
|
|
| T |
28267754 |
gctat |
28267750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University