View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4266_high_22 (Length: 289)
Name: NF4266_high_22
Description: NF4266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4266_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 10 - 275
Target Start/End: Complemental strand, 8147921 - 8147650
Alignment:
| Q |
10 |
gcacagacaagtaaacaaaataagtacttttgctttatttatctttctatgccttgggatgtttttataaaaagtgaatattcggttaaggaataaagat |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8147921 |
gcacacacaagtaaacaaaataagtacttttgctttatttatctttctatgccttgggatgtttttataaaaagtgaatattcggttaaggaataaagat |
8147822 |
T |
 |
| Q |
110 |
ctttaactctttatctccaatcaagatattcatcccaaagcctgcagataattaaacaaaaaaggtcagccccctcgttgaatgaaagagtgcatgaca- |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8147821 |
ctttaactctttatctccaatcaagatattcat-ccaaagcctgcagataattaaacaaaaaaggtcagccccctcgtggaatgaaagagtgcatgacat |
8147723 |
T |
 |
| Q |
209 |
------tactattctccattaagagtcatgtctcatacttatgattttttatgtgtctacaatagtctaaaat |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8147722 |
atatagtactattctccattaagagtcatgtctcatacttatgattttttatgtgtctacaatagtctaaaat |
8147650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University