View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4266_high_31 (Length: 240)
Name: NF4266_high_31
Description: NF4266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4266_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 17 - 131
Target Start/End: Original strand, 32483107 - 32483221
Alignment:
| Q |
17 |
cagttatcttcttctcctttacaaagagatatttctaaacgccctagagatggttcaaatgctcttgttttaactcgtaattttcatacaggtactatta |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32483107 |
cagttatcttcttctccattacaaagagatatttctaaacgccctagagatggttcaaatgctcttgtttcaactcgtaattttcatacaggtactatta |
32483206 |
T |
|
| Q |
117 |
tatgaatgtgatgca |
131 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32483207 |
tatgaatgtgatgca |
32483221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 157 - 240
Target Start/End: Original strand, 32483245 - 32483328
Alignment:
| Q |
157 |
agttaaggactggacttgtactgtgacataaggtgtaaggtgtattaatcagaagcactagcagtttccgtgattgaccctttt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483245 |
agttaaggactggacttgtactgtgacataaggtgtaaggtgtattaatcagaagcactagcagtttccgtgattgaccctttt |
32483328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University