View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4266_high_37 (Length: 224)
Name: NF4266_high_37
Description: NF4266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4266_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 20 - 208
Target Start/End: Original strand, 5676110 - 5676298
Alignment:
| Q |
20 |
cgatgttcattcaatgctcaagattcacaattgttgtaactcgcaatcacagataatctatttccatacagagataggatgtagaattagatgattgtga |
119 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5676110 |
cgatcttcattcaatggtcaagattcacaattgttgtaactcgcaatcacagataatctatttccatagagagataggatgtagaattagatgattgtga |
5676209 |
T |
 |
| Q |
120 |
gataattcatattctaagtagtagttttaaaacggatttggtgaaatcaaaatacgagtcatccaattttcatccgactgagatctgtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5676210 |
gataattcatattctaagtagtagttttaaaacggatttggtgaaatcaaaatatgagtcatccaattttcatccgactgagatctgtg |
5676298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University