View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4266_high_38 (Length: 221)
Name: NF4266_high_38
Description: NF4266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4266_high_38 |
 | |
|
| [»] scaffold1505 (1 HSPs) |
| | |
|
| [»] scaffold0070 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 51 - 207
Target Start/End: Complemental strand, 24894545 - 24894389
Alignment:
| Q |
51 |
gtatttgggtggttttattgaattctcttgggttatatttatagggttgttgtttgatttagtcacaataatgtttgcttgttgtttacgttgggaggtt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24894545 |
gtatttgggtggttttattgaattctcttgggttatatttatagggttgttgtttgatttagtcacaataatgtttgcttgttgtttacgttggaaggtt |
24894446 |
T |
|
| Q |
151 |
tatttatgttgtttaaaagaatcatgcaatgagttacaagttaaggttcatggtttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24894445 |
tatttatgttgtttaaaagaatcatgcaatgagttacaagttaaggttcatggtttt |
24894389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 51 - 207
Target Start/End: Original strand, 25629259 - 25629415
Alignment:
| Q |
51 |
gtatttgggtggttttattgaattctcttgggttatatttatagggttgttgtttgatttagtcacaataatgtttgcttgttgtttacgttgggaggtt |
150 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||| ||| |||| ||||| |
|
|
| T |
25629259 |
gtatttgggtggttttattgaattatcttgggttatatttatagggttgttgttttttttagtcacaataacgtttggttgttgtgtacattggcaggtt |
25629358 |
T |
|
| Q |
151 |
tatttatgttgtttaaaagaatcatgcaatgagttacaagttaaggttcatggtttt |
207 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
25629359 |
tatttatgttgtttgggggaattatgcaatgggttacaagttagggttcatggtttt |
25629415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 53 - 127
Target Start/End: Original strand, 25326991 - 25327067
Alignment:
| Q |
53 |
atttgggtggttttattgaattctc--ttgggttatatttatagggttgttgtttgatttagtcacaataatgtttg |
127 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
25326991 |
atttgggtgattttattgaattctctcttgggttatatttatagggttgttgtttgttttagtcacagtaatgtttg |
25327067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 119 - 207
Target Start/End: Original strand, 25327085 - 25327172
Alignment:
| Q |
119 |
taatgtttgcttgttgtttacgttgggaggtttatttatgttgtttaaaagaatcatgcaatgagttacaagttaaggttcatggtttt |
207 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| |||||| ||| |||||| |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
25327085 |
taatgtttgcttgttgtttacattgggaggtgtatt-atgttggttagaagaattatgcaatgggttacaagttagggttcatggtttt |
25327172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1505 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: scaffold1505
Description:
Target: scaffold1505; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 55 - 207
Target Start/End: Complemental strand, 1701 - 1550
Alignment:
| Q |
55 |
ttgggtggttttattgaattctcttgggttatatttatagggttgttgtttgatttagtcacaataatgtttgcttgttgtttacgttgggaggtttatt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1701 |
ttgggtggttttattgaattctcttgggttatatatatagg-ttgttgtttgttttagtcacaataatgtttgcttgttgtttacgttgggatgtttatt |
1603 |
T |
|
| Q |
155 |
tatgttgtttaaaagaatcatgcaatgagttacaagttaaggttcatggtttt |
207 |
Q |
| |
|
||||||||||| |||||| || |||| ||||||||||| ||||||||||||| |
|
|
| T |
1602 |
tatgttgtttagaagaattatacaattggttacaagttagggttcatggtttt |
1550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 207
Target Start/End: Complemental strand, 30845 - 30760
Alignment:
| Q |
122 |
tgtttgcttgttgtttacgttgggaggtttatttatgttgtttaaaagaatcatgcaatgagttacaagttaaggttcatggtttt |
207 |
Q |
| |
|
|||||||||||||||||| |||||| ||| |||||||||||||| |||||| |||||||| ||||||||||| ||||||| ||||| |
|
|
| T |
30845 |
tgtttgcttgttgtttacattgggatgttcatttatgttgtttagaagaattatgcaatgggttacaagttagggttcatagtttt |
30760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University