View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4266_low_33 (Length: 247)
Name: NF4266_low_33
Description: NF4266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4266_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 22570017 - 22570230
Alignment:
| Q |
1 |
tgttctgttacattttgaggttttgatataaggctgtagtatttctattgaagcttgattttctccttttttaaaaatcatcggaaagttaccggaagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22570017 |
tgttctgttacattttgaggttttgatataaggctgtagtatttctattgaagcttgattttctccttttttaaaaatcatcggaaagttaccggaagag |
22570116 |
T |
 |
| Q |
101 |
tc-------------tatggcaaactaatgttaaaattttcgttgaga-gtgtctatgtttgatgtttggtggtgcctcaaataggatcatcttcggtgg |
186 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22570117 |
tctaatctctcataatatggcaaactaatgttaaaattttcgttgagaggtgtctatgtttgatgtttggtggtgcctcaaataggatcatcttcggtgg |
22570216 |
T |
 |
| Q |
187 |
aagaaacttgtgat |
200 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22570217 |
aagaaacttgtgat |
22570230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University