View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4266_low_34 (Length: 242)
Name: NF4266_low_34
Description: NF4266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4266_low_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 32592783 - 32592857
Alignment:
| Q |
1 |
attagtttcttccgtcagtttgtccactagatgaatggattgaatataatagctgcctttatcattatgatgcta |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32592783 |
attagtttcttccgtcagtttgtccactagatgaatggattgaatataatagctgcctttatcattatgatgcta |
32592857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 32592907 - 32592967
Alignment:
| Q |
125 |
ggcaaaacaatagaatcttcagtaacgtatatatactttttatgtcatgtaaagagtgaca |
185 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32592907 |
ggcaaaacaatagaatcttcattaacgtatatatactttttatgtcatgtaaagagtgaca |
32592967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 7 - 55
Target Start/End: Original strand, 32602915 - 32602963
Alignment:
| Q |
7 |
ttcttccgtcagtttgtccactagatgaatggattgaatataatagctg |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32602915 |
ttcttccgtcagtttgtccactagatgaatgaattgaatataatagctg |
32602963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 146 - 185
Target Start/End: Original strand, 32603046 - 32603085
Alignment:
| Q |
146 |
gtaacgtatatatactttttatgtcatgtaaagagtgaca |
185 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
32603046 |
gtaacatatatatactttttatgtgatgtaaagagtgaca |
32603085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 233
Target Start/End: Original strand, 32592998 - 32593038
Alignment:
| Q |
193 |
acttattagcaagccatttgggttggtttgatgatgatgat |
233 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
32592998 |
acttattcccaagccatttgggtttgtttgatgatgatgat |
32593038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University