View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4266_low_44 (Length: 216)
Name: NF4266_low_44
Description: NF4266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4266_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 199
Target Start/End: Original strand, 9958888 - 9959073
Alignment:
| Q |
14 |
aagcataggttcataacttgtactgcacagcaaatcacaatgttaccatgtctcttgtgttgggaaacttggatcatattcgtataaaatatcagatata |
113 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9958888 |
aagcatagcttcataacttttactgcacagcaaatcacattgttatcatgtctcttgtgtcgggaaacttggatcatattcgtataaaatatcagatata |
9958987 |
T |
 |
| Q |
114 |
agtttgcttgataatataattgttggcattaaaagaggtaaatttagcttggttgaacaccaaattatgtgacaaagattctatgt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9958988 |
agtttgcttgataatataattgttggcattaaaagaggtaaatttagcttggttgaacaccaaattatgtgacaaagattctatgt |
9959073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University