View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4266_low_45 (Length: 216)
Name: NF4266_low_45
Description: NF4266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4266_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 38731014 - 38731198
Alignment:
| Q |
15 |
cagagaatctctctagcaaatccatacacgacatggttatgtaatttatatttttcctcaggcggtttttgttgaatacttgaatggtgagactgagaca |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38731014 |
cagaaaatctctctagcaaatccatacacgacatggttgtgtaatttatatgt--cctcaggcggtttttgttgaatacttgaatggtgagactgagaca |
38731111 |
T |
|
| Q |
115 |
tgttcttctgtagctgaaaatgatatcatctttaaaaaattgaaactagtttattcattaataatctctacaggaatatcatatatc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38731112 |
tgttcttctgtagctgaaaatgatatcatctttaaaaaattgaaactagtttattcattaataatatctacaggaatatcatatatc |
38731198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University