View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267-Insertion-18 (Length: 132)
Name: NF4267-Insertion-18
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267-Insertion-18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 5e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 5e-66
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 50397098 - 50397224
Alignment:
| Q |
1 |
accatgtcaagctcacttctcattcacaataaaccatataaaaaggacaggaacttgaataatgatagtagtgataggtaaaatccaactgagtaagcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50397098 |
accatgtcaagctcacttctcattcacaataaaccatataaaaaggacaggaacttgaataatgatagtagtgataggtaaaatccaactgagtaagcca |
50397197 |
T |
 |
| Q |
101 |
cttacaaaccaaacaggttgatgcttg |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
50397198 |
cttacaaaccaaacaggttgatgcttg |
50397224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University