View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267-Insertion-2 (Length: 112)
Name: NF4267-Insertion-2
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267-Insertion-2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 9e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 9e-52
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 43260663 - 43260553
Alignment:
| Q |
1 |
cttacttggatggcaggtaaattcctttgtagttgaagaaaaa-gtattgtaaggtggatgttttttgagtaagatttaagaacctagagtatgcctaag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43260663 |
cttacttggatggcaggtaaattcctttgtagttgaagaaaaaagtattgtaaggtggatgttttttgagtaagatttaagaacctagagtatgcctaag |
43260564 |
T |
|
| Q |
100 |
taaaacgtttt |
110 |
Q |
| |
|
||||||||||| |
|
|
| T |
43260563 |
taaaacgtttt |
43260553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 43257062 - 43256959
Alignment:
| Q |
1 |
cttacttggatggcaggtaaattcctttgtagttgaagaaaaag-tattgtaaggtggatgttttttgagtaagatttaagaacctagagtatgcctaag |
99 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||| | |||||||||||||||||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
43257062 |
cttacttggatggcaggtaaattcctaagtagttgaacaaaaaactgttgtaaggtggatgttttgtgagtaagatttaagaatcttgagtatgcctaag |
43256963 |
T |
|
| Q |
100 |
taaa |
103 |
Q |
| |
|
|||| |
|
|
| T |
43256962 |
taaa |
43256959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University