View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267-Insertion-3 (Length: 93)
Name: NF4267-Insertion-3
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267-Insertion-3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 3239489 - 3239582
Alignment:
| Q |
1 |
gccttcttatttatctgcgatgaggacgaaaa-ttatgtccagagagaagcaaatgtgaaaaagctgaggaagaatgtagaacttatagagagg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239489 |
gccttcttatttatctgcgatgaggacgaaaaattatgtccagagagaagcaaatgtgaaaaagctgaggaagaatgtagaacttatagagagg |
3239582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University