View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_high_47 (Length: 319)
Name: NF4267_high_47
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_high_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 5 - 311
Target Start/End: Complemental strand, 42341148 - 42340842
Alignment:
| Q |
5 |
cctgtttgctaatccctttctgagctgcagacaagttattgttgttgctgttattattgttggatgcagcttgttgttggttttcttctgcattccaaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341148 |
cctgtttgctaatccctttctgagctgcagacaagttattgttgttgctgttattattgttggatgcagcttgttgttggttttcttctgcattccaaat |
42341049 |
T |
|
| Q |
105 |
actacttagaaactcatccatgttcatggatccgaaattcttgccgctatcacagaggctgtgttggaactcgtcaagggtgagtgagtatatggatgac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42341048 |
actacttagaaactcatccatgttcatggatccgaaattcttgccgctatcacagaggctgtgttggaactcgtcgagggtgagtgagtatatggatgaa |
42340949 |
T |
|
| Q |
205 |
gattgccttccgagcgatgaagaaatgacattgttgacgtcattcctggtcgcttcttctccttccctctgcaatgattctacctccccttgttgccaat |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42340948 |
gattgccttccgagcgatgaagaaatgacattgttgacgtcattcctgatcgcttcttctccttccctttgcaatgattctacctccccttgttgccaat |
42340849 |
T |
|
| Q |
305 |
tcatctc |
311 |
Q |
| |
|
||||||| |
|
|
| T |
42340848 |
tcatctc |
42340842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University