View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_high_50 (Length: 305)
Name: NF4267_high_50
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_high_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 19 - 146
Target Start/End: Complemental strand, 41675710 - 41675583
Alignment:
| Q |
19 |
atatgcaacatatataatcaaacatagaatatgataaatattaatctgaagtttacttggatgtgtatataatttttcaccaatgtataaatctaataac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41675710 |
atatgcaacatatataatcaaacatagaatatgataaatattaatctgaagtttacttggatgtgtatataatttttcaccaatgtataaatctaataac |
41675611 |
T |
|
| Q |
119 |
tcactttagttaactcttaattacaatc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41675610 |
tcactttagttaactcttaattacaatc |
41675583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 213 - 298
Target Start/End: Complemental strand, 41675516 - 41675431
Alignment:
| Q |
213 |
tgtccaagatgcaacaatacatgtgaaatctaaacaatgaatccatgcaatattgcaatagacatgttcttctctagcctatgcta |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41675516 |
tgtccaagatgcaacaatacatgtgaaatctaaacaatgaatccatgcaatattgcaatagacatgttcttctctagcctatgcta |
41675431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University