View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_high_55 (Length: 296)
Name: NF4267_high_55
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 184 - 286
Target Start/End: Complemental strand, 11821890 - 11821788
Alignment:
| Q |
184 |
ttgatgcttatcaaaataataataatttgatgaaattcatctctaatattttatggcgatattagagacgaatttcatatctttttggtccctaattttc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11821890 |
ttgatgcttatcaaaataataataatttgatgaaattcatctctaatattttatggcgatattagagacgaatttcatatctttttggtccctaattttc |
11821791 |
T |
|
| Q |
284 |
atc |
286 |
Q |
| |
|
||| |
|
|
| T |
11821790 |
atc |
11821788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 11822073 - 11821973
Alignment:
| Q |
1 |
cgcacatttgtccagggtaccactgaacatggaagatagtctacttggtgtcctattctgtaaaagatcaatacatttgacatattagaaggagcactaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11822073 |
cgcacatttgtccagggtaccactgaacatggaagatagtctacttggtgtcctattctgtaaaagatcaatacatttgacatattagaaggagcactaa |
11821974 |
T |
|
| Q |
101 |
a |
101 |
Q |
| |
|
| |
|
|
| T |
11821973 |
a |
11821973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University