View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_high_56 (Length: 295)
Name: NF4267_high_56
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_high_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 284
Target Start/End: Complemental strand, 26777204 - 26776941
Alignment:
| Q |
21 |
cgtcctcctataggttgcccgatcctatgagcagcataagctccaactccagaaggcggggttgcaacatacattccggcacgtggagctggtggatcat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
26777204 |
cgtcctcctataggttgcccgatcctatgagcagcataaactccgactccagaaggcggggtcacaacatacattccggcaggtggaactggtggatcat |
26777105 |
T |
|
| Q |
121 |
ttaaagttctggtaccagcagatggagcttgaggagtttgtgtggctgattttctggcagaatcgcttgcttgatcggtaattgctccatgaggtgctga |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26777104 |
ttaaagttctggtaccagcagatggagcttgaggagtttgtgtggctgattgtcttgcataatcacttgcttgaccggtaattgctccatgaggtgctga |
26777005 |
T |
|
| Q |
221 |
aatgtctccattttcgacatatgtgacatcatgtctgctggatcgccttctttctttcttctct |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26777004 |
aatgtctccattttcgacatatgtgacatcatgtctgctggatcgccttctttctttcttctct |
26776941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 177 - 284
Target Start/End: Original strand, 26553800 - 26553907
Alignment:
| Q |
177 |
gcagaatcgcttgcttgatcggtaattgctccatgaggtgctgaaatgtctccattttcgacatatgtgacatcatgtctgctggatcgccttctttctt |
276 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||| ||||||||||||||||||||||||| |||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26553800 |
gcagaattgcttgcttgaccggtaattggtccttgaggtgctgaaatgtctccatttttgacaaaggtgacatcatgtatgctggatcgccttctttctt |
26553899 |
T |
|
| Q |
277 |
tcttctct |
284 |
Q |
| |
|
|||||||| |
|
|
| T |
26553900 |
tcttctct |
26553907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 55
Target Start/End: Original strand, 26553666 - 26553699
Alignment:
| Q |
22 |
gtcctcctataggttgcccgatcctatgagcagc |
55 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
26553666 |
gtcctcctataggttgcccgatcctaggagcagc |
26553699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University