View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_high_72 (Length: 242)
Name: NF4267_high_72
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_high_72 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 30553044 - 30552821
Alignment:
| Q |
18 |
atctttgtagataccactaaaaaagtttaaattgtggccacgattgcaactggataccacagtttagaagtattgactttattggaccatgcttcattgt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30553044 |
atctttgtagataccactaaaaaa-tttaaattgtggccacgattgcaactgggtaccacagtttagaagtattgactttattggaccatgcttcattgt |
30552946 |
T |
|
| Q |
118 |
ggtccaatgtatgaaatatatcgggactcaaaatagaacttannnnnnncttaattaaactgcagaaaaatatttctgaaggcagcaattttaatttcaa |
217 |
Q |
| |
|
|||||||||||||||| | | | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30552945 |
ggtccaatgtatgaaagagactgagactcaaaatagaacttattttttccttaattaaactgcagaaaaatatttctgaaggcagcaattttaatttcaa |
30552846 |
T |
|
| Q |
218 |
cttcaagaaattcctttcccgcact |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30552845 |
cttcaagaaattcctttcccgcact |
30552821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University