View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4267_high_74 (Length: 239)

Name: NF4267_high_74
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4267_high_74
NF4267_high_74
[»] chr3 (2 HSPs)
chr3 (68-239)||(33038333-33038506)
chr3 (19-78)||(33038514-33038573)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 68 - 239
Target Start/End: Complemental strand, 33038506 - 33038333
Alignment:
68 cttagtgtacatcccactggcatattgaggtcccacaagatggacatagacggtctacgtatgaccaaatgtataccacga--ttaggagggggcctatg 165  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||     
33038506 cttagtgtacatcccactggcatattgaggtcccacaagatgaacatagacggtctacgtatgaccaaatgtataccacgatgttaggagggggcctata 33038407  T
166 gtgaaaagctgtgaaatcgcattgttcttttcgtgaccnnnnnnngaagtctgattgctgaacgtttcttttct 239  Q
    ||||||||||||||||||||||||||||||||||||||       ||||  |||||||| ||||||||||||||    
33038406 gtgaaaagctgtgaaatcgcattgttcttttcgtgacccaaaaaagaagcatgattgctaaacgtttcttttct 33038333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 33038573 - 33038514
Alignment:
19 gggacagagtgtaaaatgaaccgggttgatttctctttcttatacgattcttagtgtaca 78  Q
    |||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||    
33038573 gggatagagtgtaaaatgaaccaggttgatttctctttcttgtacgattcttagtgtaca 33038514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University