View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_high_78 (Length: 235)
Name: NF4267_high_78
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_high_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 41 - 220
Target Start/End: Complemental strand, 7071762 - 7071583
Alignment:
| Q |
41 |
gatggtaatgttggcttcagatcttgaagtgtgcgcatcctcaatgtttgagattcttcgaatgctaatttagtgagttagatcagcttcttaataaaaa |
140 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7071762 |
gatggtaatgttggcttcaaatcttgaagtgtgcgcatcctcaatgtttgagattcttcggatgctaatttagtgagttagatcagcttcttaataaaaa |
7071663 |
T |
 |
| Q |
141 |
tatggtaattgattttttaaacttagtatatgcttcataaatgtgatttaagtatccaaatcaaatttatctatcatttt |
220 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
7071662 |
tatggtaattgatttttttaacttagtatatgtttcataaatgtgatttaagtatccaaattaaatttatcaatcatttt |
7071583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University