View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_25 (Length: 420)
Name: NF4267_low_25
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 8e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 313 - 390
Target Start/End: Original strand, 686599 - 686676
Alignment:
| Q |
313 |
catgtagtcaagctttcgagatggggaccaaagagattctttggatcggtacataaaaggttcattctttcctgttat |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
686599 |
catgtagtcaagctttcgagatggggaccaaagagattccttggatcggtacataaaaggttcattctttcctgttat |
686676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 274 - 314
Target Start/End: Original strand, 686537 - 686577
Alignment:
| Q |
274 |
taagtggtctgaatctgaactatactcttattactcacaca |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
686537 |
taagtggtctgaatctgaactatactcttattactcacaca |
686577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University