View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_33 (Length: 385)
Name: NF4267_low_33
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 18 - 373
Target Start/End: Complemental strand, 33170897 - 33170542
Alignment:
| Q |
18 |
tattgctatagacaaatttgagggactagaaggttttgtaatccaggtaatgtaacaccaagaaatttgaatcaactaggaattttctaatgccactctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33170897 |
tattgctatagacaaatttgagggactagaaggttttgtaatccaggtaatgtaacaccaagaaatctgaatcaactaggaattttctaatgccactctt |
33170798 |
T |
 |
| Q |
118 |
ttgtcctaagtcctggtgttcaaactataactagacccttactcatcattacattattcaatttgatacattgtgaatgatttgtgttgtccacaggcag |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33170797 |
ttatcctaagtcctggtgttcaaactataactagacccttactcatcattacattattcaatttgatacattgtgaatgatttgtgttgtccacaggcag |
33170698 |
T |
 |
| Q |
218 |
atcatctcaggcagcaaactctgatacacatgtcccgcatcctgtctacacaccaagctgctaggggcttgattgctcttggggaatactttcatcgcct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33170697 |
atcatctcaggcagcaaactctgatacacatgtcccgcatcctgtctacgcaccaagctgctaggggcttgattgctctaggggaatactttcatcgcct |
33170598 |
T |
 |
| Q |
318 |
tcgtactatttgttctctctggacttctcgtccattcgattccatgaggtcaccta |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33170597 |
tcgtactatttgttctctctggacttctcgtccattcgattccatgaggtcaccta |
33170542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University