View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_62 (Length: 282)
Name: NF4267_low_62
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_62 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 31 - 282
Target Start/End: Complemental strand, 51707910 - 51707657
Alignment:
| Q |
31 |
ggtaagaggatattcttcaaaaactaacatcaatattcacctgtcttcatcaatgttccaacactacgtatcatcataagctcaatttcaatctcctcct |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51707910 |
ggtaagaggatattcttcaaaaactaacatcaatattcacctgtcttcatcaatgttccaacactacgtatcatcataagctcaatttcaatctccccct |
51707811 |
T |
|
| Q |
131 |
cactattttcgagtacgatcatcatc-aaattcatcaagttgttgcaatgccgataatatatatttctccaccacattgttttgtcaatgcgaatcaatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51707810 |
cactattttcgagtacgatcatcatcaaaattcatcaagttgttgcaatgccgataatatatatttctccaccacattgttttgtcaatgcgaatcaatt |
51707711 |
T |
|
| Q |
230 |
tgttattagttcca-gagttaacaaggttaaatttaattttttctggtgttatt |
282 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51707710 |
tgttattagttctaggagttaacaaggttaaagttaattttttctggtgttatt |
51707657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University