View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_64 (Length: 279)
Name: NF4267_low_64
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 17 - 125
Target Start/End: Complemental strand, 6432279 - 6432171
Alignment:
| Q |
17 |
gaatccagttatagtgaagaagttgaatctacttcaacaagagttagaaaagatctttctcaatggcaagagagacatgcagttctcatactctcaaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6432279 |
gaatccagttatagtgaagaagttgaatctacttcaacaagagttagaaaagatctttctcagtggcaagagagacatgcagttctcatactctcaaatg |
6432180 |
T |
 |
| Q |
117 |
ttaaggtta |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
6432179 |
ttaaggtta |
6432171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 168 - 266
Target Start/End: Complemental strand, 6432129 - 6432028
Alignment:
| Q |
168 |
gttgaatagcaaatgttagtggttattattgaaactagtttaatatataaaaatcattacttattgggttttgact---aagatcaactgtagtttctgt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
6432129 |
gttgaatagcaaatgttagtggttattattgaaactagtttaatatataaaaatcataccttattgggttttgactaagaagatcaactgtagtatctgt |
6432030 |
T |
 |
| Q |
265 |
tc |
266 |
Q |
| |
|
|| |
|
|
| T |
6432029 |
tc |
6432028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University