View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_65 (Length: 278)
Name: NF4267_low_65
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 37304788 - 37304530
Alignment:
| Q |
1 |
taagcagagagttagggttagagccattgcaagtgaagttttggtttcagaacaaacgtactcaaatgaaggtatttcatttaattaatttggaggnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304788 |
taagcagagagttagggttagagccattgcaagtgaagttttggtttcagaacaaacgtactcaaatgaaggtatttcatttaattaatttggaggattt |
37304689 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnnnnggttgaaaaatgaagagtacttagaatgatttata-nnnnnnnnnnngtttgcagactcaacaggagaggcatgagaatact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304688 |
tttatttattttatttttggttgaaaaatgaagagtacttagaatgatttatattttttttttttgtttgcagactcaacaggagaggcatgagaatact |
37304589 |
T |
 |
| Q |
200 |
tcacttagaactgaaaatgagaaacttcgcgctgataacatgaggtttagagaagctct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37304588 |
tcacttagaactgaaaatgagaaacttcgcgctgataacatgaggtttagagaagctct |
37304530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 16825198 - 16825272
Alignment:
| Q |
1 |
taagcagagagttagggttagagccattgcaagtgaagttttggtttcagaacaaacgtactcaaatgaaggtat |
75 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||| |||||||||||||| |||||| | |||||||||||||||| |
|
|
| T |
16825198 |
taagcagagagttagggcttgagcctttgcaagtcaagttttggtttcaaaacaaaaggactcaaatgaaggtat |
16825272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University