View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_70 (Length: 254)
Name: NF4267_low_70
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 11 - 238
Target Start/End: Complemental strand, 28286283 - 28286063
Alignment:
| Q |
11 |
cagagactattttggaattttgtttcactgaagaactactgtgactactaaacaaaattcattcatnnnnnnnnnnnnnnnnnnnn--ttatctttgcat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28286283 |
cagagactattttggaattttgtttcactgaagaactattgtgactactaaacaaaattcattcataaaaaaaaaaaaaaaaaaaaaattatctttgcat |
28286184 |
T |
 |
| Q |
109 |
tggatgaatttttgtctcaaaaccaatccaagacgcacgacaaacaaccctagttttaatatttgtttannnnnnngaaggtgatatttctgatttataa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28286183 |
tggatgaatttttgtctcaaaaccaatccaagacgcacgacaaacaaccctagttttaatatttgtttattttttttaaggtgatatttctg-------- |
28286092 |
T |
 |
| Q |
209 |
tttagtactatatctaaatttattctatat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28286091 |
-ttagtactatatctaaatttattctatat |
28286063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 141
Target Start/End: Original strand, 29187970 - 29188014
Alignment:
| Q |
97 |
ttatctttgcattggatgaatttttgtctcaaaaccaatccaaga |
141 |
Q |
| |
|
||||||||||||| ||||| ||||| | ||||||||||||||||| |
|
|
| T |
29187970 |
ttatctttgcattagatgagtttttctttcaaaaccaatccaaga |
29188014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University