View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_80 (Length: 240)
Name: NF4267_low_80
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_80 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 12279168 - 12279391
Alignment:
| Q |
1 |
ttttgatcaatgatgatgtcaaagttgattctt-tacaatcaaagttttattaaagtttagaaaagatcaaaatatcaagattatacggttcnnnnnnnn |
99 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12279168 |
ttttgatcaatgatgatctcaaagttgattcttgtacaaacaaagttttattaaagtttagaaaagatcaaaatatcaagattgtacggttctttttttt |
12279267 |
T |
|
| Q |
100 |
nnn-aaagactaaaaatttgttcggagtaaaacatataacatttttggaattaaaataattttcacagatcaaattttaaactgtttgcttatgacaata |
198 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12279268 |
ttttaaagactaaaaatttgttcagagtaaaacatataacatttttggaattaaaataattttcatagatcaaattttaaactgtttgcttatgacaata |
12279367 |
T |
|
| Q |
199 |
aacattatactatgaaccaaaaaa |
222 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
12279368 |
aacattatactacgaaccaaaaaa |
12279391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University