View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_83 (Length: 239)
Name: NF4267_low_83
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_83 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 68 - 239
Target Start/End: Complemental strand, 33038506 - 33038333
Alignment:
| Q |
68 |
cttagtgtacatcccactggcatattgaggtcccacaagatggacatagacggtctacgtatgaccaaatgtataccacga--ttaggagggggcctatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33038506 |
cttagtgtacatcccactggcatattgaggtcccacaagatgaacatagacggtctacgtatgaccaaatgtataccacgatgttaggagggggcctata |
33038407 |
T |
|
| Q |
166 |
gtgaaaagctgtgaaatcgcattgttcttttcgtgaccnnnnnnngaagtctgattgctgaacgtttcttttct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
33038406 |
gtgaaaagctgtgaaatcgcattgttcttttcgtgacccaaaaaagaagcatgattgctaaacgtttcttttct |
33038333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 33038573 - 33038514
Alignment:
| Q |
19 |
gggacagagtgtaaaatgaaccgggttgatttctctttcttatacgattcttagtgtaca |
78 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33038573 |
gggatagagtgtaaaatgaaccaggttgatttctctttcttgtacgattcttagtgtaca |
33038514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University