View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_87 (Length: 237)
Name: NF4267_low_87
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_87 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 83 - 131
Target Start/End: Complemental strand, 28285995 - 28285947
Alignment:
| Q |
83 |
aattcaaatttacaaaaaatatttatgatatatttcagtataatacttt |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28285995 |
aattcaaatttacaaaaaatatttatgatatatttcagtataatacttt |
28285947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 16 - 58
Target Start/End: Complemental strand, 28286063 - 28286021
Alignment:
| Q |
16 |
ttataagtatgatcgtgcttagaaataaacctttatattgcta |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28286063 |
ttataagtatgatcgtgcttagaaataaacctttatattgcta |
28286021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University