View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_89 (Length: 234)
Name: NF4267_low_89
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_89 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 63 - 221
Target Start/End: Original strand, 31814892 - 31815050
Alignment:
| Q |
63 |
accaaacacacccgtaattcttatgtcccaacgctttatccacttttttgaagctgcaaagctaagcttttgcaatgaagtagtttttcacggtgattct |
162 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31814892 |
accaaacacaccctacattcttatgtcccaacgctttatccacttttttgaagctgcaaagctaagcttttgcaatgaagtagtttttcacggtgattcc |
31814991 |
T |
 |
| Q |
163 |
ggtcgagccgcagaatcaaacatgctataaataaaaaataaccttaatatgtattttat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31814992 |
ggtcgagccgcagaatcaaacatgctataaataaaaaataaccttaatatgtattttat |
31815050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 16859313 - 16859276
Alignment:
| Q |
184 |
atgctataaataaaaaataaccttaatatgtattttat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16859313 |
atgctataaataaaaaataaccttaatatgtattttat |
16859276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University