View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_93 (Length: 223)
Name: NF4267_low_93
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_93 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 19769 - 19579
Alignment:
| Q |
18 |
ataaatagttgaatttgcgcgcgtcttcatttagaacaagaagattgtgctcaagattttatagacacttgatatttccgtttgatcatggtttctacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
19769 |
ataaatagttgaatttgcgcgcgtcttcatttagaacaagaagattgtgctcaagattttatagacgcttgatatttccatttgatcatggtttctacat |
19670 |
T |
 |
| Q |
118 |
ttactcttttttgccaggaggatatataatgatgagccttcagtattggggcttttacttgttcaacattgaaatattaatattggtctgtg |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19669 |
ttactct-ttttgccaggaggatatataatgatgaaccttcagtattggtgcttttacttgttcaacattgaaatattaatattggtctgtg |
19579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University