View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_94 (Length: 222)
Name: NF4267_low_94
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 206
Target Start/End: Complemental strand, 43553174 - 43552978
Alignment:
| Q |
10 |
catcatcataacaaaggaaaaattgaaaatgtgaatcatactaagaggaaacactatcatgagatgcaccaagaggcattactaaatgcaagaaacacca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43553174 |
catcatcataacaaaggaaaaattgaaaatgtgaatcatactaagaggaaacactatcatgagatgcaccaagaggcattactaaatgcaagaaacacta |
43553075 |
T |
|
| Q |
110 |
ttgtattagtggctgttttaattgccaccgtaacttttgctgctggtattagtccacctggtggtgtgtaccaagaaggaccaatgagaggcaaatc |
206 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43553074 |
ttgtgttagtggctgttttaattgccaccgtaacttttgctgctggtattagtccacctggtggtgtgtaccaagaaggaccaatgagaggcaaatc |
43552978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 43549173 - 43548995
Alignment:
| Q |
13 |
catcataacaaaggaaaaattgaaaatgtgaatcatactaagaggaaacactatcatgagatgcaccaagaggcattactaaatgcaagaaacaccattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
43549173 |
catcataacaaaggaaaaattgaaaatgtgaatcatactaagaggaaacactatcatgagatgcacaaagaggcattactaaatgcaagaaacactattg |
43549074 |
T |
|
| Q |
113 |
tattagtggctgttttaattgccaccgtaacttttgctgctggtattagtccacctggtggtgtgtaccaagaaggacc |
191 |
Q |
| |
|
| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43549073 |
tgttagtggctgttttaattgctactgtaacttttgctgctggtattagtccacctggtggtgtgtaccaagaaggacc |
43548995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University