View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_95 (Length: 220)
Name: NF4267_low_95
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_95 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 38893359 - 38893581
Alignment:
| Q |
1 |
ccatttaaaattttatttttagtaacgataaagttttctccaacttttagttacacaat-ttttcagacaaaccaaccattcttatacgactcataattc |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38893359 |
ccatttaaaattttatttt-agtaacgataaaggtttctccaacttttagttacacaatattttcagacaaaccaaccattcttatacgactcattattc |
38893457 |
T |
|
| Q |
100 |
aaatttcccnnnnnnn---ggagaggatgattcaaatttctcttactacttgttaatcacatagatgacaagtttaccactcacaccaacgaaatggcac |
196 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38893458 |
aaatttcccttttttttttggagaggatgattcaaatgtctcttactacttgttaatcacataaatgacaagtttaccactcacaccaacgaaatggcac |
38893557 |
T |
|
| Q |
197 |
tgaaaagaagtattacaccaaaat |
220 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
38893558 |
tgaaaagaagtgttacaccaaaat |
38893581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University