View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4267_low_97 (Length: 201)

Name: NF4267_low_97
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4267_low_97
NF4267_low_97
[»] chr8 (1 HSPs)
chr8 (19-186)||(37531940-37532107)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 37532107 - 37531940
Alignment:
19 ctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcaggtgccatggggctgctcac 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37532107 ctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcaggtgccatggggctgctcac 37532008  T
119 gactcttcaatggcccaagagttttaatctcgatcggattgattatgtttgaagttgatacacaggtt 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37532007 gactcttcaatggcccaagagttttaatctcgatcggattgattatgtttgaagttgatacacaggtt 37531940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University