View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4267_low_97 (Length: 201)
Name: NF4267_low_97
Description: NF4267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4267_low_97 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 37532107 - 37531940
Alignment:
| Q |
19 |
ctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcaggtgccatggggctgctcac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532107 |
ctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcaggtgccatggggctgctcac |
37532008 |
T |
 |
| Q |
119 |
gactcttcaatggcccaagagttttaatctcgatcggattgattatgtttgaagttgatacacaggtt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532007 |
gactcttcaatggcccaagagttttaatctcgatcggattgattatgtttgaagttgatacacaggtt |
37531940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University