View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4268_high_13 (Length: 287)
Name: NF4268_high_13
Description: NF4268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4268_high_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 38149498 - 38149780
Alignment:
| Q |
1 |
cctcaaaccattcccactcctcgcaagagagatgtaagtgacttctccgcagcaattatgggcgcgatattcagggcacgtcaagtcaccatttggaccg |
100 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38149498 |
cctcaaaacattcccactactctcaagagagatggaagtgacttctccgcagcaattatgggcgcgatattcagggcacgtcaagtcaccatttggaccg |
38149597 |
T |
 |
| Q |
101 |
atgttgatggtgtatatagtgcagatcctagaaaaggtttgttctgcttcttatttcatgtgctggtttcaccatcagtggatattatacgatggtcatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38149598 |
atgttgatggtgtatatagtgcagatcctagaaaaggtttgtt---cttcttatttcatgtgctggtttcaccatcagtggatattatacgatggtcatc |
38149694 |
T |
 |
| Q |
201 |
gaattttaattctaataatacttatattgatacataccatggcannnnnnnncttcatttacttcttcactctctatatattgatga |
287 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38149695 |
gaattttaattctaataatacttatatcgatacataccatggca-tttttttcttcatttacttcttcactctctatatattgatga |
38149780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 8e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 29 - 142
Target Start/End: Complemental strand, 35096804 - 35096691
Alignment:
| Q |
29 |
gagatgtaagtgacttctccgcagcaattatgggcgcgatattcagggcacgtcaagtcaccatttggaccgatgttgatggtgtatatagtgcagatcc |
128 |
Q |
| |
|
|||||| |||||| ||||| |||||||||||||| || |||| || || ||||| ||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
35096804 |
gagatggaagtgatttctcggcagcaattatgggttcgctatttagagctcgtcaggtcacaatttggacagatgttgatggtgtgtatagtgcagatcc |
35096705 |
T |
 |
| Q |
129 |
tagaaaaggtttgt |
142 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35096704 |
tagaaaaggtttgt |
35096691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University