View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4268_high_17 (Length: 254)
Name: NF4268_high_17
Description: NF4268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4268_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 15434769 - 15434549
Alignment:
| Q |
20 |
tgcaatacttcgatcttaactattatctaccatgaactgaaattaatcaatatttattttcgaattaataacattgtgaggacatgaaaaataacaatat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15434769 |
tgcaatacttcgatcttaactattatctaccatgaactgaaattaatcaatatttattttcgaattaataacattgtgaggacatgaaaaataacaatat |
15434670 |
T |
|
| Q |
120 |
ggactacgagagtcaattctctatctggaattacacacatgtaacttagtcatcaaagaaactgtcaatagatgctggattcactcactagatagacatt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15434669 |
ggactacgagagtcaattctctatctggaattacacacatgtaacttagtcatcaaggaaactgttaatagatgctggattcactcactagatagacatt |
15434570 |
T |
|
| Q |
220 |
ggattgagctgtgttatttgt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
15434569 |
ggattgagctgtgttatttgt |
15434549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University