View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4268_high_18 (Length: 249)
Name: NF4268_high_18
Description: NF4268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4268_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 51487389 - 51487151
Alignment:
| Q |
1 |
atatgtttacactggatcattggtttctccaaacctgtaaattgaatacatccatcaatttcatgaaacacgcacaataaatgcaaattttaaatcgcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51487389 |
atatgtttacactggatcattggtttctccaaacctgtaaattgaatacatccatcaatttcatgaaacacacacaataaatgcaaattttaaatcgcga |
51487290 |
T |
 |
| Q |
101 |
gcctagagaatcggacaaaagaatgtgtacatgagatataatctaccaacgcctttgagagcaaagcagtatatcaagaaacacaagtatatcaaattca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51487289 |
gcctagagaatcggacaaaagaatgtgtacatgagatataatctaccaatgcctttgagagcaaagcagtatatcaagaaacacaagtatatcaaattca |
51487190 |
T |
 |
| Q |
201 |
taaccaaagggagaggaagtttgcaatcagtaacctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51487189 |
taaccaaagggagaggaagtttgcaatcagtaacctttg |
51487151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 66
Target Start/End: Original strand, 30199163 - 30199224
Alignment:
| Q |
6 |
tttacactggatcattggtttctccaaacctgtaaattgaat-acatccatcaatttcatga |
66 |
Q |
| |
|
|||||| |||| | |||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
30199163 |
tttacattggaaccttggtttctccagacctgtaaattgaatgacagacatcaatttcatga |
30199224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University