View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4268_high_8 (Length: 377)
Name: NF4268_high_8
Description: NF4268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4268_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 6e-50; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 255 - 359
Target Start/End: Complemental strand, 27424145 - 27424041
Alignment:
| Q |
255 |
taacttgatagcatataaaagcttttggtaaattaacagaatgattctttcaagaagacgggatgctacaatttagattgttcaggttttgttcaagccg |
354 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27424145 |
taacttgatggcatataaaagcttttggtaaattaacagaatgattctttcaagaagacgggatgctacaatttagattgttcaggttttgttcaagccg |
27424046 |
T |
|
| Q |
355 |
ataat |
359 |
Q |
| |
|
||||| |
|
|
| T |
27424045 |
ataat |
27424041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 89 - 188
Target Start/End: Complemental strand, 27424311 - 27424212
Alignment:
| Q |
89 |
gtgaacagcttgttaattttgtaatattatatacaatgtctaacatagactcaaaattatgttaggtgcttcctcaattatacaatgacgacctaactca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27424311 |
gtgaacagcttgttaattttgtaatattatatacaatgtctaacatagactcaaaattatgttaggtgcttcctcaattatacaatgacgacctaactca |
27424212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 27424393 - 27424340
Alignment:
| Q |
9 |
agataattctaatataatcacaattggatggcatgtgagtataaatttatgtaa |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27424393 |
agataattctaatataatcacaattggatggcatgtgagtataaatttatgtaa |
27424340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University