View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4269-Insertion-1 (Length: 160)
Name: NF4269-Insertion-1
Description: NF4269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4269-Insertion-1 |
 | |
|
| [»] scaffold0023 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0023 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: scaffold0023
Description:
Target: scaffold0023; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 9 - 160
Target Start/End: Complemental strand, 112311 - 112159
Alignment:
| Q |
9 |
aagaaacagacgtcagaaagcgatgga-ccggtggtgcagggacaatatagacaaccgaagagcaacaaacacagtgaatggttgggaagatggtcgtga |
107 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112311 |
aagaaacagacgtcagaaagcgatggaaccggtggtgcagggacaatatagacaaccgaagagcaacaaacacagtgaatggttgggaagatggtcgtga |
112212 |
T |
|
| Q |
108 |
gaaaggttacgataggattagtaggttttctaatcaataactgggatatctag |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112211 |
gaaaggttacgataggattagtaggttttctaatcaataactgggatatctag |
112159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University