View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4269-Insertion-4 (Length: 82)
Name: NF4269-Insertion-4
Description: NF4269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4269-Insertion-4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 3e-29; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 6403259 - 6403339
Alignment:
| Q |
1 |
tttttcttcctcaaacaaaagacttgcaactttgaaccatttctactctccgcttctgtttcaaatggaagaagatggaag |
81 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6403259 |
ttttccttcctcaaacaaaaagcttgcaactttgaaccatttccactctccgcttctgtttcaaatggaagaagatggaag |
6403339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 6419602 - 6419683
Alignment:
| Q |
1 |
tttttcttcctcaaacaaaagacttgcaactttgaaccatttctactctccgcttctgtttcaaatggaagaagatggaagc |
82 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||| |||||| ||| ||||||||| |||||||||| |
|
|
| T |
6419602 |
tttttcttcctcaaacaaaaagcttgcaactttgaaccatttccactctctgcttctctttaaaatggaagtagatggaagc |
6419683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 24 - 72
Target Start/End: Original strand, 6390033 - 6390080
Alignment:
| Q |
24 |
ttgcaactttgaaccatttctactctccgcttctgtttcaaatggaaga |
72 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
6390033 |
ttgcacctttgaaccatttc-actctctgcttctgtttcaaatggaaga |
6390080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 24 - 72
Target Start/End: Original strand, 19922838 - 19922885
Alignment:
| Q |
24 |
ttgcaactttgaaccatttctactctccgcttctgtttcaaatggaaga |
72 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
19922838 |
ttgcaactttgaaccatttc-actctctgcttctgtttcaaatggaaga |
19922885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 67
Target Start/End: Complemental strand, 19922006 - 19921964
Alignment:
| Q |
24 |
ttgcaactttgaaccatttctactctccgcttctgtttcaaatg |
67 |
Q |
| |
|
|||||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
19922006 |
ttgcaactttgaaccatttc-actctctgcttatgtttcaaatg |
19921964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University