View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4269_low_12 (Length: 264)

Name: NF4269_low_12
Description: NF4269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4269_low_12
NF4269_low_12
[»] chr7 (1 HSPs)
chr7 (9-247)||(21481737-21481975)


Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 247
Target Start/End: Original strand, 21481737 - 21481975
Alignment:
9 gaagaatattaaaaagaatgtaaaatatgaaaatcggtttgaaccaaccacggtttaacccgaggattcacaattcaattagttgaatgggatgagttta 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||    
21481737 gaagaatattaaaaagaatgtaaaatatgaaaatcggtttgaaccaaccacggtttaacccgaggattcacaattcaatgagttgaacgggatgagttta 21481836  T
109 gtctggttttttaaaactttggtttgatctcgattcaattacgccgggaactaggaaatccaaatccatgaaaattaagtaaaagaaaacattataagag 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
21481837 gtctggttttttaaaactttggtttgatctcgattcaattacgccgggaactaggaaatccaaatccatgaacattaagtaaaagaaaacattataagag 21481936  T
209 aaggctcttacaaatttgccacacttcacatcagaatat 247  Q
    |||||||||||||||||||||||||||||||||||||||    
21481937 aaggctcttacaaatttgccacacttcacatcagaatat 21481975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University