View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4269_low_13 (Length: 263)
Name: NF4269_low_13
Description: NF4269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4269_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 9499714 - 9499976
Alignment:
| Q |
1 |
ttccccacttctgcatgacccacctatggtgacctatcatttttgtggatcccccactcctctaagggtttgaaccaaagcctctcccatcaccaacccc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499714 |
ttccccatttctgcatgacccacctatggtgtcctatcatttttgtggatcccccactcctctaagggtttgaaccaaagcctctcccatcaccaacccc |
9499813 |
T |
 |
| Q |
101 |
cactttttatgaaggccttattccactccaccatttgttgcctactttcaatttctgtacatggtttgttattgtctgctagaatattatggcgtcgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9499814 |
cactttttatgaaggccttattccactccaccatttgttgcctactttcaatttctgtacatggtctgttattgtctgctagaatattatggcgtcgttt |
9499913 |
T |
 |
| Q |
201 |
gatccacttagtgggataaggctaggttgttgtttattactgtttgctgaccgttctggtatg |
263 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9499914 |
gatccactcagtgggataaggctaggttgttgtttattactgtctgctgaccgttctggtatg |
9499976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University